Transferability of simple sequence repeat (SSR) markers developed in red clover (Trifolium pratense L.) to some Trifolium species
Abstract
Microsatellite markers previously developed for red clover (Trifolium pratense L.) were used in cross-amplification tests of eight other Trifolium species. Of the 20 SSR loci tested, 9 (47.37%) had positive results and were found to be transferable to all eight species tested. The number of alleles detected at each locus ranged from 4-12, with an average of 7.2 in T. tumens Steven ex M. Bieb., 5.8 in T. resupinatum L., 5.1 in T. fragiferum L., 4.5 in T. tomentosum L., 3.4 in T. bullatum Boiss. & Hausskn. ex Boiss., 3.2 in T. clusii Godr. & Gren., 2.7 in T. spumosum L. and 2.1 in T. physodes Stev. ex M. B. This study has shown that SSR markers developed for red clover effectively amplify DNA from other species and this approach may be applicable for the analysis of intra- and interspecific genetic diversity of target Trifolium species for which, until now, no information about their genomic SSR status has been available.
Keywords: Cross-species transferability, Genomic SSR, Trifolium, T. pratense .
Introduction
Microsatellites, or Simple Sequence Repeats (SSRs), are one of the most useful DNA markers for studying population genetic structure and dynamics (Moreno et al., 2011; Zhang and Hewitt, 2003). However, the main limit on the use of these markers for analysis of genetic diversity in different species is the high cost for developing specific primers (Miranda et al., 2012). Thus, a more widespread use of SSRs in plants would be facilitated if we were able to transfer SSR loci across species (Manoj et al.
, 2013; Gutierrez et al., 2005). Many studies on comparative genetics have revealed that gene content and order are highly conserved among closely related plant species (Manoj et al., 2013; Kalia et al., 2011; Varshney et al., 2005; Kuleung et al., 2004). It is assumed successful transferability depends on the extent of sequence conservation in the primer sites flanking the microsatellite loci and the stability of these sequences during evolution (Moreno et al., 2011; Zhang and Hewitt, 2003). Therefore, primer pairs designed based on the sequences obtained from one species could be used to detect microsatellites in related species. Several studies have also demonstrated the successful cross-transferability of SSR markers from one species to other species of the same genus (Miranda et al., 2012; Castillo et al., 2008; Gimenes et al., 2007; Alves et al., 2006; Bravo et al., 2006). The cross-transferability of SSRs is mainly useful in comparative genome mapping and phylogenetic studies. Also, this method of microsatellite detection is especially useful in species where neither sequence information nor the genetic maps are available (Manoj et al., 2013).
The genus Trifolium L. is organized into eight sections including 255 species (Gillett and Taylor, 2001; Zohary and Heller, 1984). Many members of this species have agronomic value, including red clover (T. pretense), white clover (T. repens), strawberry clover (T. fragiferum), and Persian clover (T. resupinatum). Except for red and white clovers, little information is available on the genomics of other members of the genus.Thus, in the present study, we studied the transferability of 20 red clover SSR loci to eight new targets species belonging to Fragifera (T. fragiferum, T. tumens, T. physodes, T. resupinatum, T. tomentosum, T. bullatum, T. clusii) and Mistyllus (T. spumosum) sections.
Materials and Methods
Plant materials and DNA extraction
Eight Trifolium species were studied: T. fragiferum, T. tumens, T. physodes, T. resupinatum, T. tomentosum, T. bullatum, T. clusii and T. spumosum. Plants of each species were identified morphologically according to Haerinasab and Rahiminejad (2012).
Leaves from 8 populations of T. fragiferum, 12 populations of T. tumens, 1 population of T. physodes, 11 populations of T. resupinatum, 6 populations of T. bullatum, 3 populations of T. clusii, 14 populations of T. tomentosum and 2 populations of T. spumosum were sampled to test transferability of primers previously developed in red clover (T. pratense ). Genomic DNA was extracted according to Ellison et al. (2006). DNA concentration was estimated on 0.8% agarose gels.
Microsatellite markers and PCR analysis
Twenty primer pairs previously developed for T. pratense (Sato et al., 2005) (Table 1) were tested in the eight target species.
Table 1 – Primer Sequences and characteristics of 20 tested red clover specific SSR primer pairs.
Alelle frequency |
Reverse primer (5? to 3?) |
Forward primer(5? to 3?) |
Calculated size(bp) |
SSR motif |
SSR ID |
No |
12 |
GAAGAGATAGCTTGCCTTGGA |
CACGTTACTCAATTTGGATCTTTG |
157 |
AAG |
RCS0883* |
1 |
9 |
TGGGGAAGTGAAGGATGTTC |
ATTTGAGCACAAGGCCTCAC |
206 |
AAC |
RCS0907 |
2 |
6 |
ATCAACTCGATGGGAACACC |
TTTTCTGGCGACGAATTAGG |
199 |
AG |
RCS1479 |
3 |
14 |
GATTTCGATCCTCCTCCTCC |
AATAACAATATGCGGCTTTGC |
162 |
AAG |
RCS2773 |
4 |
13 |
GCAGATTATGAGGAATAACATTG |
AAATTATCATTTTGCAAATTTTA |
182 |
AAT |
RCS0033 |
5 |
12 |
TTCAATCGGGAGTGTCAGTG |
CGATTGCTACAAACACAGCC |
139 |
AC |
RCS2343 |
6 |
4 |
GGTGCTAGCTCCAACCTCAG |
CCTGCTCCGTACCATTGTTT |
189 |
AAC |
RCS1735* |
7 |
8 |
GGTGGTGTTGCTGATTACGA |
CCTCAGCAGAATCTTCACCC |
208 |
AAG |
RCS2667* |
8 |
9 |
CCCCCAAAATACAAAACCCT |
GAGAAAAGAAAGAAGTCTCTGAAGGA |
220 |
AAG |
RCS1920* |
9 |
6 |
CCTTTCAGAACAGATGGCGT |
TACCCTCTTGAGCACCCATT |
243 |
AGC |
RCS1928* |
10 |
11 |
CGGCAGACGAAGTGACAAAT |
GCCGATATTGCTAGGTTGGA |
110 |
AC |
RCS2202* |
11 |
8 |
CTCGCTGAAGGAGGAAACAG |
TGCAAACTCCGCTTTATGC |
200 |
ATC |
RCS1225* |
12 |
10 |
AGCTCAAGCTCAACGGACAT |
GGCACGAGGCACACTACTTC |
107 |
ATC |
RCS1737 |
13 |
6 |
CGAAGCAGGTTGGAAAACAT |
GCACGAGGCACACACTACTT |
188 |
ATC |
RCS1518 |
14 |
7 |
TTGGCATCTCAAAGCTGAAA |
GCCAAGCCCACCAATACATA |
231 |
GGAT |
RCS0843 |
15 |
15 |
TCTGTTTCTTGTCTCGGCCT |
CATGGCTGCCTGAGGTTAAT |
212 |
AC |
RCS3666* |
16 |
11 |
CACTAATTCAGACCACCAGCA |
TCGGTGAGCTGTGACTAACG |
217 |
AAC |
RCS3052 |
17 |
8 |
AAACAAACCAAGCAGCACCT |
ACGGTGGAATTATGGGATGA |
244 |
ATC |
RCS1327 |
18 |
11 |
TTCAACATGCAGGCTAAGAAAA |
CGCAATCTTTCTTCTCATTTCA |
199 |
AAG |
RCS0793 |
19 |
8 |
ATGAGCACCTTCACCAATCC |
CATGTCAGCATATCCATTTTCC |
280 |
AAAG |
RCS1897* |
20 |
* Microsatellite loci that generated amplification products in this study.
PCR amplifications were carried out in a volume of 25 ?l, containing 1? buffer, 0.2 mM of each dNTP, 250 nM of each SSR primer (forward, reverse), 1.5 mM of MgCl2, 50-100 ng template genomic DNA and 1.2 units of Taq DNA Polymerase.
In order to improve the PCR results, the maximum and minimum optimal annealing temperatures of each pair of primers to be tested were determined (See Table 2.). The PCR thermal profile for all species was as follows: denaturation period of 4 min at 94°C, followed by twenty cycles of 1 min at 94°C, 1 min at the maximum optimal temperature for each primer pair, and 1 min at 72°C, followed by 15 cycles of 1 min at 94°C, 1 min at the minimum optimal temperature for each primer pair, 1 min at 72°C, and a final extension for 10 min at 72°C. PCR products were separated on a 10% non-denaturing polyacrylamide gel using 1? TBE buffer and visualized by the silver staining method of Tixier et al. (1997), with the exception of using NaOH instead of NaCO3. All SSR fragments for the 57 populations were scored manually.
Data analysis
The results for the 20 loci were summarized for each species in a vector of 0 (no amplification) and 1 (successful amplification). The number of total alleles detected in all eight species was determined for each SSR locus. The polymorphic information content (PIC) of each SSR marker was calculated using the formula: PIC = 1 – ?(Pi)2 (Botstein et al., 1980) where Pi is the frequency of the ith allele calculated for each SSR marker.
Results and discussion
Twenty SSR primer pairs developed for T. pratense were tested for their ability to amplify across eight other species of Trifolium (T. fragiferum, T. tumens, T. physodes, T. resupinatum, T. tomentosum, T. bullatum, T. clusii and T. spumosum). Transferability was successful for 9 (47.37%) SSRs in all species tested. From these microsatellites, all of the 9 primers were polymorphic in the target species.
Our results are in accordance with many previous studies that have shown interspecific transferability of SSRs, for example across species of Araucariaceae (31.8 to 77.3%; Moreno et al., 2011), in the genus Glycine (65%; Peakall, et al., 1998), from Hordeum vulgare to H. bulbosum (51.61%; Khodayari et al., 2011) and to H. chilense (26%; Castillo et al., 2008), from Arachis hypogaea to other Arachis species (63.1%; Gimenes et al., 2007), from Theobroma cacao to Theobroma grandiflorum (60.4%; Alves et al., 2006), and across species of the genus Arachis (78%; Bravo et al., 2006). Usually, closely related species share similar SSR priming sites, resulting in a high frequency of cross-species amplification. Our findings provide clear evidence for the potential transferability of SSRs across Trifolium species and demonstrate that these priming site are located in conserved regions of the genome.
In the present study, the number of alleles detected at each locus ranged from 4 to 12, with an average of 7.2 in T. tumens, 5.8 in T. resupinatum, 5.1 in T. fragiferum, 4.5 in T. tomentosum, 3.4 in T. bullatum, 3.2 in T. clusii, 2.7 in T. spumosum and 2.1 in T. physodes. A maximum of 65 alleles were detected for T. tumens, while only 19 alleles were detected for T. physodes. The number of alleles detected by all transferable SSR loci is listed in Table 2. The number of alleles for each primer determined in this study is different from what has been reported for red clover by Sato et al. (2005), except for the RCS1920 and RCS2667 loci (See Table 1 and 2.). According to Wang et al. (2009), this may have occurred because of the different methodologies used, namely capillary electrophoresis in the genotyping studies where these markers were originally described and polyacrylamide gel electrophoresis in the present study. Another possible explanation is that these differences are the result of variations in the number of tandem repeat polymorphisms on the tested loci. We also found differences in reproducibility of amplifications, with variable fragment sizes, compared with what has been reported for red clover by Sato et al. (2005). Bravo et al. (2006) argue that there may be considerable variation both in the number of repetitions as well in the levels of polymorphism between the species for which SSR markers were previously developed and the species that showed a cross reaction.
The PIC values for 9 SSR primers varied from 0.45 for RCS3666 to 0.65 for RCS0883 (Table 2).
Table 2. The results of cross-amplification of red clover SSR primers across other Trifolium species.
PIC |
N0. of alleles |
Fragment size (bp) |
Annealing temp. range (°C) |
SSR ID |
|||||||
T. spumosum |
T. tomentosum |
T. clusii |
T. bullatum |
T. resupinatum |
T. tumens |
T. physodes |
T. fragiferum |
||||
0.65 |
9 |
9 |
10 |
9 |
12 |
10 |
4 |
11 |
150-230 |
47-55 |
RCS0883 |
0.59 |
1 |
2 |
2 |
2 |
3 |
4 |
1 |
5 |
190-210 |
48-52 |
RCS1225 |
0.64 |
3 |
7 |
1 |
4 |
8 |
10 |
2 |
11 |
160-310 |
46-52 |
RCS1735 |
0.61 |
1 |
7 |
5 |
3 |
9 |
5 |
1 |
4 |
220-320 |
46-52 |
RCS1920 |
0.51 |
3 |
4 |
1 |
4 |
4 |
5 |
4 |
4 |
205-250 |
50-58 |
RCS1928 |
0.59 |
1 |
2 |
2 |
2 |
4 |
8 |
1 |
3 |
190-250 |
48-52 |
RCS2667 |
0.45 |
1 |
1 |
1 |
1 |
1 |
4 |
1 |
2 |
190-235 |
48-52 |
RCS3666 |
0.59 |
4 |
8 |
6 |
5 |
5 |
9 |
4 |
4 |
75-125 |
48-51 |
RCS2202 |
0.51 |
1 |
1 |
1 |
1 |
6 |
10 |
1 |
2 |
250-320 |
48-52 |
RCS1897 |
0.57 |
2.6 |
4.5 |
3.2 |
3.4 |
5.7 |
7.2 |
2.1 |
5.1 |
Mean |
In conclusion, the cross-species transferability observed in this study demonstrates the utility of red clover SSRs for the analysis of intra- and interspecific genetic diversity and evolutionary studies of other Trifolium species, for which no information on genomic SSRs is available. Our findings provide encouragement for the establishment of effective strategies for conservation of pastureland genetic resources, along the lines proposed by Barbara et al. (2007). As highlighted by Noor & Feder (2006), the possibility of cross amplification of genetic markers allows comparative studies among closely related taxa to be carried out, as well as providing some insight into the genetic mechanisms of speciation and population divergence.
References
Alves, R. M., Sebbenn, A. M., Artero, A. S. & Figueira, A. (2006). Microsatellite loci transferability from Theobroma cacao to Theobroma grandiflorum. Molecular Ecology Notes, 6, 1219-1221.
Barbara, T., Palma-Silva, C., Paggi, G. M., Bered, F., Fay, M. F. & Lexer, C. (2007). Cross-species transfer of nuclear microsatellite markers: potential and limitations. Molecular Ecology, 16, 3759-3767.
Botstein, D., White, R. L., Skolnick, M. & Davis, R. W. (1980). Construction of a genetic linkage map in man using restriction fragment length polymorphisms. The American Journal of Human Genetics, 32(3), 314–331
Bravo, J. P., Akemi, H. A., Lara, C. M., Angelici, C. D., Lopes, C. R. & Gimenes, M. A. (2006). Transferability and use of microsatellite markers for the genetic analysis of the germplasm of some Arachis section species of the genus Arachis. Genetics and Molecular Biology, 29(3), 516-524.
Castillo, A., Budak, H., Varshney, R. K., Dorado, G., Graner, A. & Hernandez, P. (2008). Transferability and polymorphism of barley EST-SSR markers used for phylogenetic analysis in Hordeum chilense. BMC Plant Biology, 8, 97.
Ellison, N. W., Liston, A., Steiner, J. Williams, M. & Taylor, N. (2006). Molecular phylogenesis of the Clover genus (Trifolium – Leguminnosae). Molecular phylogenetics and evolution, 39, 688-705.
Gillett, J. M. & Taylor, N. L. (2001). The World of Clovers. Iowa State University Press, Ames, Iowa, USA.
Gimenes, M. A., Hoshino, A. A., Barbosa, A. V. G., Palmieri, D. A. & Lopes, C. R. (2007). Characterization and transferability of microsatellite markers of the cultivated peanut (Arachis hypogaea). BMC Plant. Biology, 7, 1-13.
Gutierrez, M. V., Vaz Patto, M. C., Huguet, T., Cubero, J. I., Moreno, M. T. & Torres, A. M. (2005). Cross-species amplii¬?cation of Medicago truncatula microsatellites across three major pulse crops. Theoretical and Applied Genetics, 110, 1210–1217.
Haerinasab, M. & Rahiminejad, M. R. (2012). A taxonomic revision of the genus Trifolium L. sect. Fragifera Koch (Fabaceae) in Iran. Iranian Journal of Botany, 18 (1), 22-30.
Kalia, R. K., Rai, M. K., Kalia, S., Singh, R. & Dhawan, A. K. (2011). Microsatellites markers: an overview of the recent progress in plants. Euphytica, 177, 309–334.
Khodayari, H., Saeidi, H., Rahiminejad, M. R. & Komatsuda, T. (2011). Transferability and polymorphism of barley microsatellite Markers across H-genome containing species in the genus Hordeum (H. vulgare and H. bulbosum). Iranian Journal of Botany, 17 (2), 200-211.
Kuleung, C, Baenziger, P. S. & Dweikat, I. (2004). Transferability of SSR markers among wheat, rye, and triticale. Theoretical and Applied Genetics, 108, 1147–1150.
Miranda, F. D., Gontijo, A. B. P. L., Santiliano, F. C., Favoreto, F. C. & Soares, T. C. B. (2012). Transferability and Characterization of Microsatellite Markers in five Bromeliaceae species belonging to the subfamilies Pitcairnioideae and Bromelioideae. Biota Neotropica, 12(3), 319-323.
Rai, M. K., Phulwaria, M. & Shekhawat, N. S. (2013). Transferability of simple sequence repeat (SSR) markers developed in guava (Psidium guajava L.) to four Myrtaceae species. Molecular Biology Reports, 40(8), 5067-5071.
Moreno, A. C., Marchelli, P., Vendramin, G. G. & Gallo, L. A. (2011). Cross transferability of SSRs to five species of Araucariaceae: a useful tool for population genetic studies in Araucaria araucana. Forest Systems, 20(2), 303-314.
Noor, M. A. F. & Feder, J. L. (2006). Speciation genetics: evolving approaches. Nature Reviews Genetics, 7, 851-861.
Peakall, R., Gilmore, S., Keys, W., Morgante, M. & Rafalski, A. (1998). Cross-species amplification of soybean (Glycine max) simple sequence repeats (SSRs) within the genus and other legume genera: implications for the transferability of SSRs in plants. Molecular Biology and Evolution, 15, 1275-1287.
Sato, S., Isobe, S., Asamizu, E., Ohmido, N., Nakamura, Y., Kaneko, T., Sakurai, N., Okumura, K., Klimenko, I., Sasamoto, S., Wada, T., Watanabe, A., Kohara, M., Fujishiro, T. & Tabata, S. (2005). Comprehensive structural analysis of the genome of red clover (Trifolium pratense L.). DNA Research, 12, 301-364.
Tixier, M. H., Sourdille, P., Roder, M., Leroy, P. & Bernard, M. (1997). Detection of wheat microsatellites using a non-radioactive silver-nitrate staining method. Journal of Genetics and Breeding, 51, 175-177.
Varshney, R. K., Graner, A. & Sorrells, M. E. (2005). Genic microsatellite markers in plants: features and applications. Trends in Biotechnology, 23, 48–55.
Zhang, D. X. & Hewitt, G. M. (2003). Nuclear DNA analyses in genetic studies of populations: practice, problems and prospects. Molecular Ecology, 12, 563-584.
Zohary, M. & Heller, D. (1984). The genus Trifolium. The Israel Academy of Science and Humanities. Jerusalem, Israel.
Essay Writing Service Features
Our Experience
No matter how complex your assignment is, we can find the right professional for your specific task. Contact Essay is an essay writing company that hires only the smartest minds to help you with your projects. Our expertise allows us to provide students with high-quality academic writing, editing & proofreading services.Free Features
Free revision policy
$10Free bibliography & reference
$8Free title page
$8Free formatting
$8How Our Essay Writing Service Works
First, you will need to complete an order form. It's not difficult but, in case there is anything you find not to be clear, you may always call us so that we can guide you through it. On the order form, you will need to include some basic information concerning your order: subject, topic, number of pages, etc. We also encourage our clients to upload any relevant information or sources that will help.
Complete the order formOnce we have all the information and instructions that we need, we select the most suitable writer for your assignment. While everything seems to be clear, the writer, who has complete knowledge of the subject, may need clarification from you. It is at that point that you would receive a call or email from us.
Writer’s assignmentAs soon as the writer has finished, it will be delivered both to the website and to your email address so that you will not miss it. If your deadline is close at hand, we will place a call to you to make sure that you receive the paper on time.
Completing the order and download